Bio::Tools::Run::StandAloneNCBIBlast man page on Fedora

Man page or keyword search:  
man Server   31170 pages
apropos Keyword Search (all sections)
Output format
Fedora logo
[printable version]

Bio::Tools::Run::StandUsereContributed)Bio::Tools::Run::StandAloneNCBIBlast(3)

NAME
       Bio::Tools::Run::StandAloneNCBIBlast - Object for the local execution
       of the NCBI BLAST program suite (blastall, blastpgp, bl2seq). With
       experimental support for NCBI rpsblast.

SYNOPSIS
	# Do not use directly; see Bio::Tools::Run::StandAloneBlast

DESCRIPTION
       See Bio::Tools::Run::StandAloneBlast

FEEDBACK
   Mailing Lists
       User feedback is an integral part of the evolution of this and other
       Bioperl modules. Send your comments and suggestions preferably to one
       of the Bioperl mailing lists.  Your participation is much appreciated.

	 bioperl-l@bioperl.org			- General discussion
	 http://bioperl.org/wiki/Mailing_lists	- About the mailing lists

   Support
       Please direct usage questions or support issues to the mailing list:

       bioperl-l@bioperl.org

       rather than to the module maintainer directly. Many experienced and
       reponsive experts will be able look at the problem and quickly address
       it. Please include a thorough description of the problem with code and
       data examples if at all possible.

   Reporting Bugs
       Report bugs to the Bioperl bug tracking system to help us keep track
       the bugs and their resolution.  Bug reports can be submitted via the
       web:

	 http://bugzilla.open-bio.org/

AUTHOR - Peter Schattner
       Email schattner at alum.mit.edu

MAINTAINER - Torsten Seemann
       Email torsten at infotech.monash.edu.au

CONTRIBUTORS
       Sendu Bala  bix@sendu.me.uk (reimplementation)

APPENDIX
       The rest of the documentation details each of the object methods.
       Internal methods are usually preceded with a _

   new
	Title	: new
	Usage	: my $obj = Bio::Tools::Run::StandAloneBlast->new();
	Function: Builds a newBio::Tools::Run::StandAloneBlast object
	Returns : Bio::Tools::Run::StandAloneBlast
	Args	: -quiet => boolean # make program execution quiet
		  -_READMETHOD => 'BLAST' (default, synonym 'SearchIO') || 'blast_pull'
				  # the parsing method, case insensitive

       Essentially all BLAST parameters can be set via StandAloneBlast.pm.
       Some of the most commonly used parameters are listed below. All
       parameters have defaults and are optional except for -p in those
       programs that have it. For a complete listing of settable parameters,
       run the relevant executable BLAST program with the option "-" as in
       blastall - Note that the input paramters (-i, -j, -input) should not be
       set directly by you: this module sets them when you call one of the
       executable methods.

       Blastall

	 -p  Program Name [String]
	       Input should be one of "blastp", "blastn", "blastx",
	       "tblastn", or "tblastx".
	 -d  Database [String] default = nr
	       The database specified must first be formatted with formatdb.
	       Multiple database names (bracketed by quotations) will be accepted.
	       An example would be -d "nr est"
	 -e  Expectation value (E) [Real] default = 10.0
	 -o  BLAST report Output File [File Out]  Optional,
		   default = ./blastreport.out ; set by StandAloneBlast.pm
	 -S  Query strands to search against database (for blast[nx], and tblastx). 3 is both, 1 is top, 2 is bottom [Integer]
		   default = 3

       Blastpgp (including Psiblast)

	 -j  is the maximum number of rounds (default 1; i.e., regular BLAST)
	 -h  is the e-value threshold for including sequences in the
		   score matrix model (default 0.001)
	 -c  is the "constant" used in the pseudocount formula specified in the paper (default 10)
	 -B  Multiple alignment file for PSI-BLAST "jump start mode"  Optional
	 -Q  Output File for PSI-BLAST Matrix in ASCII [File Out]  Optional

       rpsblast

	 -d  Database [String] default = (none - you must specify a database)
	       The database specified must first be formatted with formatdb.
	       Multiple database names (bracketed by quotations) will be accepted.
	       An example would be -d "Cog Smart"
	 -e  Expectation value (E) [Real] default = 10.0
	 -o  BLAST report Output File [File Out]  Optional,
		   default = ./blastreport.out ; set by StandAloneBlast.pm

       Bl2seq

	 -p  Program name: blastp, blastn, blastx. For blastx 1st argument should be nucleotide [String]
	   default = blastp
	 -o  alignment output file [File Out] default = stdout
	 -e  Expectation value (E) [Real]  default = 10.0
	 -S  Query strands to search against database (blastn only).  3 is both, 1 is top, 2 is bottom [Integer]
	   default = 3

   blastall
	Title	: blastall
	Usage	:  $blast_report = $factory->blastall('t/testquery.fa');
	       or
		      $input = Bio::Seq->new(-id=>"test query",
					     -seq=>"ACTACCCTTTAAATCAGTGGGGG");
		      $blast_report = $factory->blastall($input);
	       or
		     $seq_array_ref = \@seq_array;
		# where @seq_array is an array of Bio::Seq objects
		     $blast_report = $factory->blastall($seq_array_ref);
	Returns : Reference to a Blast object containing the blast report.
	Args	: Name of a file or Bio::Seq object or an array of
		  Bio::Seq object containing the query sequence(s).
		  Throws an exception if argument is not either a string
		  (eg a filename) or a reference to a Bio::Seq object
		  (or to an array of Seq objects).  If argument is string,
		  throws exception if file corresponding to string name can
		  not be found.

   blastpgp
	Title	: blastpgp
	Usage	:  $blast_report = $factory-> blastpgp('t/testquery.fa');
	       or
		      $input = Bio::Seq->new(-id=>"test query",
					     -seq=>"ACTADDEEQQPPTCADEEQQQVVGG");
		      $blast_report = $factory->blastpgp ($input);
	       or
		     $seq_array_ref = \@seq_array;
		# where @seq_array is an array of Bio::Seq objects
		     $blast_report = $factory-> blastpgp(\@seq_array);
	Returns : Reference to a Bio::SearchIO object containing the blast report
	Args	: Name of a file or Bio::Seq object. In psiblast jumpstart
		  mode two additional arguments are required: a SimpleAlign
		  object one of whose elements is the query and a "mask" to
		  determine how BLAST should select scoring matrices see
		  DESCRIPTION above for more details.

		  Throws an exception if argument is not either a string
		  (eg a filename) or a reference to a Bio::Seq object
		  (or to an array of Seq objects).  If argument is string,
		  throws exception if file corresponding to string name can
		  not be found.
	Returns : Reference to Bio::SearchIO object containing the blast report.

   rpsblast
	Title	: rpsblast
	Usage	:  $blast_report = $factory->rpsblast('t/testquery.fa');
	       or
		      $input = Bio::Seq->new(-id=>"test query",
					     -seq=>"MVVLCRADDEEQQPPTCADEEQQQVVGG");
		      $blast_report = $factory->rpsblast($input);
	       or
		     $seq_array_ref = \@seq_array;
		# where @seq_array is an array of Bio::Seq objects
		     $blast_report = $factory->rpsblast(\@seq_array);
	Args	: Name of a file or Bio::Seq object or an array of
		  Bio::Seq object containing the query sequence(s).
		  Throws an exception if argument is not either a string
		  (eg a filename) or a reference to a Bio::Seq object
		  (or to an array of Seq objects).  If argument is string,
		  throws exception if file corresponding to string name can
		  not be found.
	Returns : Reference to a Bio::SearchIO object containing the blast report

   bl2seq
	Title	: bl2seq
	Usage	: $factory-> bl2seq('t/seq1.fa', 't/seq2.fa');
	       or
		 $input1 = Bio::Seq->new(-id=>"test query1",
					 -seq=>"ACTADDEEQQPPTCADEEQQQVVGG");
		 $input2 = Bio::Seq->new(-id=>"test query2",
					 -seq=>"ACTADDEMMMMMMMDEEQQQVVGG");
		 $blast_report = $factory->bl2seq ($input1,  $input2);
	Returns : Reference to a BPbl2seq object containing the blast report.
	Args	: Names of 2 files  or 2 Bio::Seq objects containing the
		  sequences to be aligned by bl2seq.

		  Throws an exception if argument is not either a pair of
		  strings (eg filenames) or references to Bio::Seq objects.
		  If arguments are strings, throws exception if files
		  corresponding to string names can not be found.

   _generic_local_blast
	Title	: _generic_local_blast
	Usage	: internal function not called directly
	Returns : Bio::SearchIO
	Args	: Reference to calling object and name of BLAST executable

   _runblast
	Title	:  _runblast
	Usage	:  Internal function, not to be called directly
	Function:   makes actual system call to Blast program
	Example :
	Returns : Report Bio::SearchIO object in the appropriate format
	Args	: Reference to calling object, name of BLAST executable,
		  and parameter string for executable

   _setparams
	Title	: _setparams
	Usage	: Internal function, not to be called directly
	Function: Create parameter inputs for Blast program
	Example :
	Returns : parameter string to be passed to Blast
	Args	: Reference to calling object and name of BLAST executable

perl v5.14.1			  2011-Bio::Tools::Run::StandAloneNCBIBlast(3)
[top]

List of man pages available for Fedora

Copyright (c) for man pages and the logo by the respective OS vendor.

For those who want to learn more, the polarhome community provides shell access and support.

[legal] [privacy] [GNU] [policy] [cookies] [netiquette] [sponsors] [FAQ]
Tweet
Polarhome, production since 1999.
Member of Polarhome portal.
Based on Fawad Halim's script.
....................................................................
Vote for polarhome
Free Shell Accounts :: the biggest list on the net