Bio::Map::Microsatellite man page on Fedora

Man page or keyword search:  
man Server   31170 pages
apropos Keyword Search (all sections)
Output format
Fedora logo
[printable version]

Bio::Map::MicrosatelliUser)Contributed Perl DocumenBio::Map::Microsatellite(3)

NAME
       Bio::Map::Microsatellite - An object representing a Microsatellite
       marker.

SYNOPSIS
	 $o_usat = Bio::Map::Microsatellite->new
	     (-name=>'Chad Super Marker 2',
	      -sequence => 'gctgactgatcatatatatatatatatatatatatatatatcgcgatcgtga',
	      -motif => 'at',
	      -repeats => 15,
	      -repeat_start_position => 11
	      );

	 $sequence_before_usat = $o_usat->get_leading_flank();
	 $sequence_after_usat = $o_usat->get_trailing_flank();

DESCRIPTION
       This object handles the notion of an Microsatellite. This
       microsatellite can be placed on a (linear) Map or used on its own.  If
       this Microsatellites will be used in a mapping context (it doesn't have
       to, you know) it can have multiple positions in a map. For information
       about a Microsatellite's position in a map one must query the associate
       PositionI object which is accessible through the position() method.

FEEDBACK
   Mailing Lists
       User feedback is an integral part of the evolution of this and other
       Bioperl modules. Send your comments and suggestions preferably to the
       Bioperl mailing list.  Your participation is much appreciated.

	 bioperl-l@bioperl.org			- General discussion
	 http://bioperl.org/wiki/Mailing_lists	- About the mailing lists

   Support
       Please direct usage questions or support issues to the mailing list:

       bioperl-l@bioperl.org

       rather than to the module maintainer directly. Many experienced and
       reponsive experts will be able look at the problem and quickly address
       it. Please include a thorough description of the problem with code and
       data examples if at all possible.

   Reporting Bugs
       Report bugs to the Bioperl bug tracking system to help us keep track of
       the bugs and their resolution. Bug reports can be submitted via the
       web:

	 http://bugzilla.open-bio.org/

AUTHOR - Chad Matsalla
       Email bioinformatics1@dieselwurks.com

CONTRIBUTORS
       Heikki Lehvaslaiho heikki-at-bioperl-dot-org Lincoln Stein
       lstein@cshl.org Jason Stajich	  jason@bioperl.org Sendu Bala
       bix@sendu.me.uk

APPENDIX
       The rest of the documentation details each of the object methods.
       Internal methods are usually preceded with a _

   new
	Title	: new
	Usage	: $o_usat =
	Function: Builds a new Bio::Map::Microsatellite object
	Returns : Bio::Map::Microsatellite
	Args	:
	       -name	=> name of this microsatellite (optional, string,
		       default 'Unknown microsatellite')
	       -positions => position(s) for this marker in maps[optional],
		       An array reference of tuples (array refs themselves)
		       Each tuple conatins a Bio::Map::MapI-inherited object and a
		       Bio::Map::PositionI-inherited obj, no default)
	       -sequence => the sequence of this microsatellite (optional,
			scalar, no default)
	       -motif => the repeat motif of this microsatellite (optional,
			scalar, no default)
	       -repeats => the number of motif repeats for this microsatellite
		       (optional, scalar, no default)
	       -repeat_start_position => the starting position of the
		       microsatellite in this sequence. The first base of the
		       sequence is position "1". (optional, scalar, no default)

	Note	: Creating a Bio::Map::Microsatellite object with no position
	       might be useful for microsatellite people wanting to embrace
	       and extend this module. <raising hand> Me! Me! Me!
	       - using repeat_start_position will trigger a mechinism to
	       calculate a value for repeat_end_position.

   motif
	Title	: motif
	Usage	: $o_usat->motif($new_motif);
		      my $motif = $o_usat->motif();
	Function: Get/Set the repeat motif for this Microsatellite.
	Returns : A scalar representing the current repeat motif of this
		      Microsatellite.
	Args	: none to get, OR string to set

   sequence
	Title	: sequence
	Usage	: $o_usat->sequence($new_sequence);
		      my $sequence = $o_usat->sequence();
	Function: Get/Set the sequence for this Microsatellite.
	Returns : A scalar representing the current sequence of this
		      Microsatellite.
	Args	: none to get, OR string to set

   repeats
	Title	: repeats
	Usage	: $o_usat->repeats($new_repeats);
		      my $repeats = $o_usat->repeats()
	Function: Get/Set the repeat repeats for this Microsatellite.
	Returns : A scalar representing the current number of repeats of this
		      Microsatellite.
	Args	: none to get, OR int to set

   repeat_start_position
	Title	: repeat_start_position
	Usage	: $o_usat->repeat_start_position($new_repeat_start_position);
		      my $repeat_start_position = $o_usat->repeat_start_position();
	Function: Get/Set the repeat repeat_start_position for this
		      Microsatellite
	Returns : A scalar representing the repeat start position for this
		      Microsatellite.
	Args	: none to get, OR string to set
		      This method will also try to set the repeat end position. This
		      depends on having information for the motif and the number of
		      repeats. If you want to use methods like get_trailing_flank or
		      get_leading flank, be careful to include the right information.

   repeat_end_position
	Title	: repeat_end_position
	Usage	: $o_usat->repeat_end_position("set");
		      $o_usat->repeat_end_position($value);
		      $current_repeat_end_position = $o_usat->repeat_end_position();
	Function: Get/set the end position of the repeat in this sequence.
	Returns : A scalar representing the base index of the end of the
		      repeat in this Microsatellite. The first base in the sequence
		      is base 1.
	Args	: A scalar representing a value, the string "set", or no
		      argument (see Notes).
	Notes	: If you do not provide an argument to this method, the current
		  end position of the repeat in this Microsatellite will be
		  returned (a scalar).
		  If you provide the string "set" to this method it will set the
		  end position based on the start position, the length of the
		  motif, and the number of repeats.
		  If you specify a value the current end position of the repeat
		  will be set to that value. This is a really bad idea. Don't do
		  it.

   equals
	Title	: equals
	Usage	: if ($mappable->equals($mapable2)) {...}
	Function: Test if a position is equal to another position
	Returns : boolean
	Args	: Bio::Map::MappableI

   less_than
	Title	: less_than
	Usage	: if ($mappable->less_than($m2)) {...}
	Function: Tests if a position is less than another position
	Returns : boolean
	Args	: Bio::Map::MappableI

   greater_than
	Title	: greater_than
	Usage	: if ($mappable->greater_than($m2)) {...}
	Function: Tests if position is greater than another position
	Returns : boolean
	Args	: Bio::Map::MappableI

   get_leading_flank
	Title	: get_leading_flank
	Usage	: $leading_sequence = $o_usat->get_leading_flank();
	Returns : A scalar representing the sequence before the repeats in this
		      Microsatellite.
	Args	: none

   get_trailing_flank
	Title	: get_trailing_flank
	Usage	: $trailing_flank = $o_usat->get_trailing_flank();
	Returns : A scalar representing the sequence after the repeats in this
		      Microsatellite.
	Args	: none

perl v5.14.1			  2011-07-22	   Bio::Map::Microsatellite(3)
[top]

List of man pages available for Fedora

Copyright (c) for man pages and the logo by the respective OS vendor.

For those who want to learn more, the polarhome community provides shell access and support.

[legal] [privacy] [GNU] [policy] [cookies] [netiquette] [sponsors] [FAQ]
Tweet
Polarhome, production since 1999.
Member of Polarhome portal.
Based on Fawad Halim's script.
....................................................................
Vote for polarhome
Free Shell Accounts :: the biggest list on the net